An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119687.1

General info


NONCODE TRANSCRIPT IDNONHSAT119687.1
NONCODE Gene IDNONHSAG096230.2
Chromosomechr7
Start Site27147482
End Site27152703
Strand+
Exon Number3
CNCI Score-0.0368640
Length621
Assemblyhg38
Other transcript VersionsNONHSAT119687.1(old version)

Sequence


>NONHSAT119687.1
CGAGGCGCCACTGAGGTCCTTATCAGAATAGAAACACGAGGCCCCGTACTCGTAGGACGCCCGGTTGCAGGCCAGGACCGAGTTGGACTGTTGGTAGAAACAAGAATTCCACCCACGCACCTATTCCCCCTCCCAGCGCTTCAGACACCTCTCTCATCGAAAAACCGGGCGAAGGGAAGCCGGCAACGAGCGGAGAACTCTGGCTGAATTAACGGTGGCTCCCAGAAGCTCCTGCCCCTCTGACAGCTGTCGCTTGGGCAGCCCGAGAGAAGAATTGTCCTCTTTCCTGGTGCCAGAGGACGCAGGAAATTAGCCAGGTTGCGAGTTGCAAAGCTGCTGCCGCGGCGCCGGGAACGGAGCGCGCCCAATCTCCAGCGGGAGCCGCCAGGCCTGGCCTGGCCGGGGCTTCCCTTCGCTCGCCATCTCCGGACAAAGCACAGCCGAGCCCGGCTGGAAGGCAGAGCTCCGAAGCAGGCAGGACGGAGCGGAGCAAAAGAATGCGGCTCTATTCTCGCAAGGGAAATTATAAAAAAGTTCATGTTCACGGTTCTCATCCACATGACCGACAGCGGCCAATGGAAGGGCCGAACAACTCATAAAGTTGTATTGCAAAGTTGTAAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211841.1
NONHSAT253216.1
NONHSAT253217.1
NONHSAT119682.2
NONHSAT119683.2
NONHSAT119684.2
NONHSAT119688.2

Data Sources

Source NameOld Id
lncipedialnc-EVX1-8-4_dup1
noncodeV3n380162
PMID26117828PNCT_HSA297858
ensemblENST00000521231
NONCODEv4NONHSAT119687
gencodeENST00000521231.1