An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119700.1

General info


NONCODE TRANSCRIPT IDNONHSAT119700.1
NONCODE Gene IDNONHSAG047190.2
Chromosomechr7
Start Site27171932
End Site27172180
Strand-
Exon Number1
CNCI Score-0.1462272
Length248
Assemblyhg38
Other transcript VersionsNONHSAT119700.1(old version)

Sequence


>NONHSAT119700.1
ATGCCAGGCAATTCCAAAGGTGAAAACGCAGCCAACTGGCTCACGGCAAAGAGTGGTCGGAAGAAGCGCTGCCCCTACACGAAGCACCAGACACTGGAGCTGGAGAAGGAGTTTCTGTTCAATATGTACCTTACTCGAGAGCGGCGCCTAGAGATTAGCCGCAGCGTCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAACTGAAGAAAATGAATCGAGAAAACCGGAT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3n334065
NONCODEv4NONHSAT119700
lncipedialnc-HOXA9-1-7