An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119704.1

General info


NONCODE TRANSCRIPT IDNONHSAT119704.1
NONCODE Gene IDNONHSAG047191.3
Chromosomechr7
Start Site27185396
End Site27189293
Strand+
Exon Number2
CNCI Score-0.0557056
Length1560
Assemblyhg38
Other transcript VersionsNONHSAT119704.1(old version)

Sequence


>NONHSAT119704.1
CTTTCTTTGTAGCCACCTCAGGGGAAGCAACAGATCGTCACTCGGTGTTCTCACCGAAAGCACGTAATCGCCGGTGTAACTCATGTTGGCTGGGGGGCCTCCCGGCGCGCGCGGAGAGGCTGGGGTGCGCCCCCATGCAGCATGCTTGTGCTCAATTGCAGGGTCCTCGTTCTCGAGTGTGCAGAGGGCGGTGAGAGCTCAACTCTCGTCCCCACCTCCCACCCGCAGCTCCCCGGGTGGGTGAGGGATGCCCTGGACTGGGGATAGCCAGGTGGGAGTCCGTCGCTGTGTGGCCTGTGGTCTCGGAGTCTGTTCTCCTGGAGTCTCGCATTTGCACCCCCTTCTTCGCAGTCCCCCTCCCATAGACTTGCTCTGGGAAGCGCCTCTGCCTCCGACCCTAGCCGGAACCCCTTCGGGGCCAGAGTTTGAAGCCGTGGATGTGCCTGCCTGGTGGCTTGTCCGATTTGCACGGTGACTTGATTACACTCTCTCATTCATGGTCACTTCCGAAGCGCTTTAGTGCCTTCCGTCCCTAAACCGCCAACAGCCAGAACGGCTTCTCCCCGCGGTTTGTCACTGATCCGCAGGGCCCGGAAGGGCCTTCGTCTTACCCGGGATCCACCTCTCCCCTCATCTTCCCTGCCTACCTCTTCATCCCACCTTCTGTCCTTGGAGAAACTCCCTCCTCCTCGCTGCCTGCCGGGCTTCGGAGTGACTCGGCAGAGACAGAGGCACAGGGGCTGCCCTGCTGCTCACCGGTCCACCCATCTGCCTGGTCTTCTGGAGCTGAGGACTCGGGAAACCATGCAATTGAGGCAAGCCTTGGGCTGCTTTAGAGGCGCTGACATCCGAGGAGACTTCTCCTGGGAGGTCCAACAGCCGAGCTTAGCCCACCGGGCTCTGGGAAAGACCCGACTGAGGCTAAAGCCGCCCCGGAAGGCCAAGTCCGAGTTCCATTTCTTGAAGAGGCCGGCGCGCGTAAGGCTGTGACATTGGCCCTGGCGACTGGCTTCCCAGGAGCTGTTCTTTCTCAGGAGCTCCACAGCGCGGGCCATCTCCAGAAAACTGTCTTCAGAGTGTATTTCCTTTTATCGTCAACCCAGAGCCCCACCGCGGCTAATGCAAGAGGCCAAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCGGCGGCCTGACGGTGCGTGTGTGTCTGCAGAGAAGGGAGGGAGCCGGCTCAGTCTCTTCTTGTTTTTCCAAACTTCAAGGTCCAGGCAGCCCTCTGCAGGGCCGGGCCCCATTGCTCCCCGCGCGGCATTGGAGGTGGCCGCCCGGAGAGGAGAAGGCCAACGCCTGCGCCAGGCTTGTCAGGCGGAAACGGCTAACAAGGAGATTTGGTCAGCAAAACAGACCCAGCCTTTCCGAGGCTTCGTCTGACTTGGCCCGAAAGGTTGGGGAGGGGGGGCTTGCGCAGAGCCTCAGGGACCCTCCTCTCTGGGGACTACCATCCCTGAGCCTTACGCTTCTTTCCACAGCCTTTGCAGGCGGAATATCGGAATAAAGTGGGTCCAGGCGCC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211844.1
NONHSAT253219.1
NONHSAT253220.1
NONHSAT119702.2
NONHSAT119703.2
NONHSAT119705.2
NONHSAT119706.2
NONHSAT119709.2
NONHSAT119710.2
NONHSAT119711.2

Data Sources

Source NameOld Id
NONCODEv4NONHSAT119704
lncrnadbhoxa11as_homosapiens_1
PMID24108091m121219_004319_00126_c100
PMID26117828PNCT_HSA297870
ensemblENST00000522674
noncodeV3n343005
lncipedialnc-EVX1-5-4_dup1
gencodeENST00000522674.1
refseqNR_002795
NAMEHOXA11-AS