An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119705.1

General info


NONCODE TRANSCRIPT IDNONHSAT119705.1
NONCODE Gene IDNONHSAG047191.3
Chromosomechr7
Start Site27185412
End Site27189167
Strand+
Exon Number3
CNCI Score-0.0577536
Length931
Assemblyhg38
Other transcript VersionsNONHSAT119705.1(old version)

Sequence


>NONHSAT119705.1
CTCAGGGGAAGCAACAGATCGTCACTCGGTGTTCTCACCGAAAGCACGTAATCGCCGGTGTAACTCATGTTGGCTGGGGGGCCTCCCGGCGCGCGCGGAGAGGCTGGGGTGCGCCCCCATGCAGCATGCTTGTGCTCAATTGCAGGGTCCTCGTTCTCGAGTGTGCAGAGGGCGGTGAGAGCTCAACTCTCGTCCCCACCTCCCACCCGCAGCTCCCCGGAGACAGAGGCACAGGGGCTGCCCTGCTGCTCACCGGTCCACCCATCTGCCTGGTCTTCTGGAGCTGAGGACTCGGGAAACCATGCAATTGAGGCAAGCCTTGGGCTGCTTTAGAGGCGCTGACATCCGAGGAGACTTCTCCTGGGAGGTCCAACAGCCGAGCTTAGCCCACCGGGCTCTGGGAAAGACCCGACTGAGGCTAAAGCCGCCCCGGAAGGCCAAGTCCGAGTTCCATTTCTTGAAGAGGCCGGCGCGCGTAAGGCTGTGACATTGGCCCTGGCGACTGGCTTCCCAGGAGCTGTTCTTTCTCAGGAGCTCCACAGCGCGGGCCATCTCCAGAAAACTGTCTTCAGAGTGTATTTCCTTTTATCGTCAACCCAGAGCCCCACCGCGGCTAATGCAAGAGGCCAAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCGGCGGCCTGACGGTGCGTGTGTGTCTGCAGAGAAGGGAGGGAGCCGGCTCAGTCTCTTCTTGTTTTTCCAAACTTCAAGGTCCAGGCAGCCCTCTGCAGGGCCGGGCCCCATTGCTCCCCGCGCGGCATTGGAGGTGGCCGCCCGGAGAGGAGAAGGCCAACGCCTGCGCCAGGCTTGTCAGGCGGAAACGGCTAACAAGGAGATTTGGTCAGCAAAACAGACCCAGCCTTTCCGAGGCTTCGTCTGACTTGGCCCGAAAGG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211844.1
NONHSAT253219.1
NONHSAT253220.1
NONHSAT119702.2
NONHSAT119703.2
NONHSAT119704.2
NONHSAT119706.2
NONHSAT119709.2
NONHSAT119710.2
NONHSAT119711.2

Data Sources

Source NameOld Id
lncipedialnc-EVX1-5-5_dup1
NONCODEv4NONHSAT119705
PMID26117828PNCT_HSA107397