An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119709.1

General info


NONCODE TRANSCRIPT IDNONHSAT119709.1
NONCODE Gene IDNONHSAG047191.3
Chromosomechr7
Start Site27187818
End Site27189220
Strand+
Exon Number2
CNCI Score-0.0598016
Length822
Assemblyhg38
Other transcript VersionsNONHSAT119709.1(old version)

Sequence


>NONHSAT119709.1
CTAGGAAAACCGAAAACAGTTCTAGACAGACCTGCGGTTTTATAGCAGTTTTGGCAGTCAACTTCAGCTTGTGCCTGAGCAGACGGGGTTGTGGTGGCCCGCCAGCGGGGGATGCCAGGCCACCTCCCCCAGCGGCACGCAGCCCCTCTCTTAATTAGATCGGTTTTCCCCTGGTGTCCGGGAGAGCGGTCCCGGCAGAAAGGAGGTCCAACAGCCGAGCTTAGCCCACCGGGCTCTGGGAAAGACCCGACTGAGGCTAAAGCCGCCCCGGAAGGCCAAGTCCGAGTTCCATTTCTTGAAGAGGCCGGCGCGCGTAAGGCTGTGACATTGGCCCTGGCGACTGGCTTCCCAGGAGCTGTTCTTTCTCAGGAGCTCCACAGCGCGGGCCATCTCCAGAAAACTGTCTTCAGAGTGTATTTCCTTTTATCGTCAACCCAGAGCCCCACCGCGGCTAATGCAAGAGGCCAAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCGGCGGCCTGACGGTGCGTGTGTGTCTGCAGAGAAGGGAGGGAGCCGGCTCAGTCTCTTCTTGTTTTTCCAAACTTCAAGGTCCAGGCAGCCCTCTGCAGGGCCGGGCCCCATTGCTCCCCGCGCGGCATTGGAGGTGGCCGCCCGGAGAGGAGAAGGCCAACGCCTGCGCCAGGCTTGTCAGGCGGAAACGGCTAACAAGGAGATTTGGTCAGCAAAACAGACCCAGCCTTTCCGAGGCTTCGTCTGACTTGGCCCGAAAGGTTGGGGAGGGGGGGCTTGCGCAGAGCCTCAGGGACCCTCCTCTCTGGGGACTA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211844.1
NONHSAT253219.1
NONHSAT253220.1
NONHSAT119702.2
NONHSAT119703.2
NONHSAT119704.2
NONHSAT119705.2
NONHSAT119706.2
NONHSAT119710.2
NONHSAT119711.2

Data Sources

Source NameOld Id
ensemblENST00000479766
NONCODEv4NONHSAT119709
PMID26117828PNCT_HSA297872
lncipedialnc-EVX1-5-7_dup1
gencodeENST00000479766.1
noncodeV3Human
noncodeV3n369560