An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119710.1

General info


NONCODE TRANSCRIPT IDNONHSAT119710.1
NONCODE Gene IDNONHSAG047191.3
Chromosomechr7
Start Site27188028
End Site27189293
Strand+
Exon Number2
CNCI Score-0.0512000
Length918
Assemblyhg38
Other transcript VersionsNONHSAT119710.1(old version)

Sequence


>NONHSAT119710.1
GGGGGTGTGCGCTGTTCCGCATAACCACTGCCTCCCATGTCCTCCTCGAGGGCCGAACCGAGAGGGTGCTGGCAGGGCTGGATCCCACGGGTGTCCGCAGGAGACAAAGGCGAATTCCGGAGAAAAGGCTGGGGCTGAGAAAGGCGCTCCGGGAGCGGCTGGCAGGGCAATTCGGCAGGCTGCACCGAAGCCGAGTGCCCGGAGGGACTTGCCGCCCGGAAGGGGGAGGTCCAACAGCCGAGCTTAGCCCACCGGGCTCTGGGAAAGACCCGACTGAGGCTAAAGCCGCCCCGGAAGGCCAAGTCCGAGTTCCATTTCTTGAAGAGGCCGGCGCGCGTAAGGCTGTGACATTGGCCCTGGCGACTGGCTTCCCAGGAGCTGTTCTTTCTCAGGAGCTCCACAGCGCGGGCCATCTCCAGAAAACTGTCTTCAGAGTGTATTTCCTTTTATCGTCAACCCAGAGCCCCACCGCGGCTAATGCAAGAGGCCAAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCGGCGGCCTGACGGTGCGTGTGTGTCTGCAGAGAAGGGAGGGAGCCGGCTCAGTCTCTTCTTGTTTTTCCAAACTTCAAGGTCCAGGCAGCCCTCTGCAGGGCCGGGCCCCATTGCTCCCCGCGCGGCATTGGAGGTGGCCGCCCGGAGAGGAGAAGGCCAACGCCTGCGCCAGGCTTGTCAGGCGGAAACGGCTAACAAGGAGATTTGGTCAGCAAAACAGACCCAGCCTTTCCGAGGCTTCGTCTGACTTGGCCCGAAAGGTTGGGGAGGGGGGGCTTGCGCAGAGCCTCAGGGACCCTCCTCTCTGGGGACTACCATCCCTGAGCCTTACGCTTCTTTCCACAGCCTTTGCAGGCGGAATATCGGAATAAAGTGGGTCCAGGCGCC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211844.1
NONHSAT253219.1
NONHSAT253220.1
NONHSAT119702.2
NONHSAT119703.2
NONHSAT119704.2
NONHSAT119705.2
NONHSAT119706.2
NONHSAT119709.2
NONHSAT119711.2

Data Sources

Source NameOld Id
noncodeV3n767
lncipedialnc-EVX1-5-8_dup1
PMID26117828PNCT_HSA297873
PMID26117828Hoxa
NONCODEv4NONHSAT119710