An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT119711.1

General info


NONCODE TRANSCRIPT IDNONHSAT119711.1
NONCODE Gene IDNONHSAG047191.3
Chromosomechr7
Start Site27188600
End Site27189293
Strand+
Exon Number1
CNCI Score-0.0225280
Length693
Assemblyhg38
Other transcript VersionsNONHSAT119711.1(old version)

Sequence


>NONHSAT119711.1
GAGGTCCAACAGCCGAGCTTAGCCCACCGGGCTCTGGGAAAGACCCGACTGAGGCTAAAGCCGCCCCGGAAGGCCAAGTCCGAGTTCCATTTCTTGAAGAGGCCGGCGCGCGTAAGGCTGTGACATTGGCCCTGGCGACTGGCTTCCCAGGAGCTGTTCTTTCTCAGGAGCTCCACAGCGCGGGCCATCTCCAGAAAACTGTCTTCAGAGTGTATTTCCTTTTATCGTCAACCCAGAGCCCCACCGCGGCTAATGCAAGAGGCCAAAAAATGTTTGGAGGAAGAAAAACAAAGGCAGGAAGTGGCGGCGGCCTGACGGTGCGTGTGTGTCTGCAGAGAAGGGAGGGAGCCGGCTCAGTCTCTTCTTGTTTTTCCAAACTTCAAGGTCCAGGCAGCCCTCTGCAGGGCCGGGCCCCATTGCTCCCCGCGCGGCATTGGAGGTGGCCGCCCGGAGAGGAGAAGGCCAACGCCTGCGCCAGGCTTGTCAGGCGGAAACGGCTAACAAGGAGATTTGGTCAGCAAAACAGACCCAGCCTTTCCGAGGCTTCGTCTGACTTGGCCCGAAAGGTTGGGGAGGGGGGGCTTGCGCAGAGCCTCAGGGACCCTCCTCTCTGGGGACTACCATCCCTGAGCCTTACGCTTCTTTCCACAGCCTTTGCAGGCGGAATATCGGAATAAAGTGGGTCCAGGCGCC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT211844.1
NONHSAT253219.1
NONHSAT253220.1
NONHSAT119702.2
NONHSAT119703.2
NONHSAT119704.2
NONHSAT119705.2
NONHSAT119706.2
NONHSAT119709.2
NONHSAT119710.2

Data Sources

Source NameOld Id
lncipedialnc-EVX1-5-9_dup1
PMID26117828Hoxa
NONCODEv4NONHSAT119711
noncodeV3n766