An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT120953.1

General info


NONCODE TRANSCRIPT IDNONHSAT120953.1
NONCODE Gene IDNONHSAG047748.2
Chromosomechr7
Start Site63908965
End Site63910453
Strand-
Exon Number1
CNCI Score-0.0008192
Length1488
Assemblyhg38
Other transcript VersionsNONHSAT120953.1(old version)

Sequence


>NONHSAT120953.1
AATGGAGTATATGACAGAATCGACTGACCGCAGCCCTGGACTCATCCTGTGCTGTGAGTGTGGTATTGCAATAAGTCCCAATCCTGCCAATATTTGTGTGGCCTGTTTGCAAAGTAAAGTGGGCATCAGCCAAGATATTCCAAAACAAGTCTCACTTTTGTTCTACAAACAATGTCAAAGGTATTTTCAGCCACCAGGAACTTGGATACGGTGTGCTTTAGAATCCAGGGAACTTCTTGCTTTGTGTTCAAAGCCCCTCTGAGTAAGGAACGGCTTGTGAATGCAGGCTTTGTTTGGACTGAGCCCCATTCTAAGAGATTTAAAGTTAAACTGACTCCAGAAAGAGGTGATGAATGGTGCTGTCCTTCAACAAGTGTTTGTGGTGGATTATGCTGTTCAGTCCCAAATATGTGGAGATTGCCATAGAGTAGAAGCTAAGGGTTTCTGGAGGGCTGTGATTCAAGTGAGGCAAAAGACTTTGCACAAAAAAGCTTTCTACTATCTGGAACAGTTAATTCTGAAATATGGAAGGCATCAGAATACACTTCGTATCAAAGAGATTCATGATGGTCTGGATTTTTATTATTCCTCAAAACCACATGCTCAGAAGATGGTCGAATTTATTCAGTATACAGTTCCCTGTAGATACAACGCATCCCAAAGACTGATCTCTCAGGATGTCCATAGTAATACATACAATTACAAAAGCACTTTTTCTGTGGAAATTGTTCCAATATGCCAGGATTATGTTGTCTGTCTGTCTCCAAAACTGACACAAAGCCTGGGAAATATGAACCAGATTTGTGTGTGTATTCGAATAACCAGTGCCATTCACCTCATTGATCCAAACACCCTACAAGTTGCAGATATTGATGGCAGCACTTTCTGGAGTCACTCTTTCAGTAGTTTATGTCACCCCAAACAGCTAGAGGAATTTATTGTGATGAAATGCAGCATAGTCCGAAATATAAAACACGGTGCAGATGCTGGAATGATATCAAAAAAGCATACCCTCAGGGAAGTCTGGGTACAGAAGACATCTGAAATGAATACAGATAAACAGTATTTTTGTCATACTCATTTGGGACATCTTCTAAATCCTGGAGAGCTGGTGTTAGGGTTTGATTTGGCCAGCTGCAATTTAAATGATGAGCATGGCAACAAAATGAACTCAGATAGAGTTCCAGATGTGGTATTAATCAAGAAGAACTAAGACTGGACCAAACATCAGTGATGTAGAAACTGGAAACTGAAAGAGCTTGCAGGAGAGAGAACATGGATACAGATGATGAAAGGCAATACCAAGATTTTCTTGAAGATCTTGAAGAAGATGAGGCAATTAGAAAAAATGTCAACATTTACAGAGAGTCAACCATCCCTGTGGAAAGTGATGATGATGAAGGAGCACCTGGAATTAGTCTGGCTGAGATGCCTGAAGACTTTCATATTTCCCACGATGCCACTGGTGAAGAAGGTGCGTCAATGATG

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
NONCODEv4NONHSAT120953
ensemblENST00000439704
lncipedialnc-ZNF680-33-1_dup1