An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT121054.1

General info


NONCODE TRANSCRIPT IDNONHSAT121054.1
NONCODE Gene IDNONHSAG047796.1
Chromosomechr7
Start Site64348904
End Site64350478
Strand-
Exon Number3
CNCI Score-0.1865850
Length1062
Assemblyhg19
Other transcript VersionsNONHSAT121054.2

Sequence


>NONHSAT121054.1
CCTCACAGCCCTGAGTGAGGGTGTGCAGCCTCCTTGGGCAAGAGGATGCGGGCTCTGGGAGGCTGCGTCGCACATCTCCAGTCCCCACTGCAGGGCCTCTCACCGGCTGGGGCAGTGACCCCTGGTCGGAAGCACCTCAGTGCTGCTCATGATTGCAGAGGTGGCCTCACCAGATAGAGGGTCCTGGAGGGCGTGGGGGCTTGGTCTCTGACTGCCAGCAAAAGAAGCCGACATAGAGGCAGCAGGCGACAAACACTGAGGCAACTGACTTGCCCGAATTTAACCCTCAGGTTTTTTAAATAAAATGCAAGTGCAGGGGCTTGGGCTCGGGACTCCTGGAGCCCCGTGGGGCTGAGCGTGGATGGTGCTCGGTGTCCAGCTACACTCCCAAACCGCATCCCGAGCGTTTGCGGGGCGGAGGGGCCCCAGGGCGACGGTTCCAGAACAGACCCAGGCGGCTCCGGTCAGCAGCAGCCCCGCTGCTTTCCAACAGCGCGGGGACCCCCATCCCCGCCAGCCCCATCTCACTGTCCCTCTCAGGTCAGAGGAGACCGTAGAGGACCGCGTGGCACCAGGAGCTGCCAGGAACCAGGGCGACCTAGAAGAAACCGGGAACCTGGCGTCCCGCGGGGACGCAGCCCCAGGAAAGGGGCTGCCGCCGCCAGCAAGTGAGCTCAGCTCAGCCCGGGCGTCCCCTCCGCAACGAGGCCCGGATCCCTGCTTGGCTCCCGGAGCCCGGACTGTGCCTTCCGCAAAACGGCTGCGCTCTAGAAAGTGGCCTCCACAGTGCACTTCCCGGCAGCATGGAGTCGGCAGTGGCAGCGTTTCTATCCGGCTCTGCGGGGCTGGGTGTGAACGGGACTCTCCCATCCCGCTGTCCTCCAGGAGCCGGACCTCTCACCCCGAAGACTTTGCCGAAGACGCGGCCCCCTGGTCAGGGGCAGAAAACAGATCCAGGCCGCCCCGCTCCTGCTGGGTGGTGGAGAAGGTGGAGGGCGGGCAGGTGCTAAGTGCTACTGTGAAAATAAAAATCATCATAATAAAGAACGAATGGGTTTCGTA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT121054
PMID26117828PNCT_HSA108688
lncipedialnc-ZNF117-1-1
gencodeENST00000340779.3
ensemblENST00000340779