An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT122757.1

General info


NONCODE TRANSCRIPT IDNONHSAT122757.1
NONCODE Gene IDNONHSAG048547.2
Chromosomechr7
Start Site109998433
End Site109999624
Strand-
Exon Number1
CNCI Score-0.0446464
Length1191
Assemblyhg38
Other transcript VersionsNONHSAT122757.1(old version)

Sequence


>NONHSAT122757.1
CTGTCTAACTGGAAGTTCACTGTTCCCTGGCTTGGGTCCCTAGGCTTCCTGCCTTGGAAGCGCAGCAGCAGGCTTCATGGGAAGGTGAAGAGCTTCCCTAAGGATGAACCTTCCAAGCCATTCCACCTCACAGCCTTCCTGGGATACAAGGCTGGTATGGCCTACATCATGTGAGAAGCTGACAGCCCAGGATCCAAGGTGAACAAGGAAGTGGTAGAGGCTGTGACAGTTGTGGAGACACCGCCCATGGTAGTTGTGGGCATTGTGGCTATATGGAAATCGCTCAAGGCCTCCAGACCTTCAAGACTGTCTTTGCTGAGCACATCAGCAATGAATGCAAAGGTGTTTCCATAAGAACCGGCATAATCTATAAAGATGGCCTTTACCAAGTACTACAAGAAATGGCAGAATGAGGATGGCAACAAGCAGCTGGAGAAGGAATTCAACAGCATGAAAATGTACTGCCAAGTCATCTCTATCATTGCCCATACTTAGATGTGCCTGCTTCCTCTGTGCCAGAAGAAGGCACGCCGATGGAGATCCAGGTGAACTGAGGCACTGTGGCTGAGAAACTGGACTGAGCCTGGGAAATGCTAGAGCACCAGGTCCCTGTGAACCAAGTATTTGGGTAGGACAGGGTAATTGATGCCATTGAGGTGACCAAGTGCAAAGGCTACAAAAGGGGTCACCAGTCATTGGCACACCAAGAAGCTGACCCACAAGACCCACCAAAGGCTGTGTAAGGCTCCTTATATCAGGATGTGGCATCCTGCCTGTGTGGCCTTCTCTGTGGCATGTGCTGGGCAGAAAGGCTACCATCACTGCACTGAGAATAACAAGAAAATCTGTAACATTGGCCATGGCTACCTTACGAAGGATGAAAAATGGATCAAGAACAATGCCTCCACTGATGGTGACCTGTCCGACAAGAGCATCAACCCTCTGGGTGGCTTTGTCCACTATAATGAAATGAACAATGACTTTGTCATGCTGAAAGGCTGTGTGGTGGGAATCAAGAAGTGAGTGCTCACCTCCGCAAGCCTTTGATGGTGCAGACCAAGCGTCCTGCTCTGGAGAAGACTGACCTTAAGTTCATCAACACTGTTTCCAGGTTTGGCCGTGACCACTTCCAGACCATGGAGGAGAAGAACCACTAAAAAAGACCAGATTGCAAAGCAAGAAGGAGCTTAA

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
lncipedialnc-IMMP2L-7-1_dup1
ensemblENST00000432928
NONCODEv4NONHSAT122757