An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT123119.1

General info


NONCODE TRANSCRIPT IDNONHSAT123119.1
NONCODE Gene IDNONHSAG048709.2
Chromosomechr7
Start Site126532882
End Site126534798
Strand+
Exon Number2
CNCI Score-0.0131072
Length1013
Assemblyhg38
Other transcript VersionsNONHSAT123119.1(old version)

Sequence


>NONHSAT123119.1
AGGAAAAGCATCCTAAAAGAAGATGTTAAATCCAGGAAAAAGTTGTCAAGTGTATTTCCTTCTACTTACCTTTTCTGCTGACTGGGCTGTACCAAAAAAGATGGGGATGAAAGCTAACCAAATGATGCAGGTGGTATACATGGTAAATCCAATAGGTTTGGCTTCATTGAAAGTCTCTGGGACACCTCTCGTTTTAATGGCATAAACAGTACAAGTGACCATCAAGAGGATACTGTATCCAAGTGAACAAATGAGTGAGAGATCAGAAATGTCACACTTGAGCACTCCCCTGGCCTTCTCTGGATCTAGTGTCCGCTGCTCTCCATAGTCAATGATGATGTGGGGGGGATCCACAACAAACCAGACAAACACTCCAAGGAGCTGGACGGAGATGAGGCTGAAGGTGATCACCAGCTGAGATGCTGGACTAATGAACTTGGGCGCTGTGACAGATTTCTTCCCCTGCTCAAATATTCGGTGGATACGGTTTGTTTTGGTCAGAAGGGCTGCATAGCTGAAACACATGCCAAGTCCTAGGAAGACCCGTCGGAAGGAGCATATGATTGTATCTGGTGCTGCAATCATTAAAAACGTGATTGAATAACAGAGAAAAATCCCCGTTAGGAGCACGTAACTAAGTTCGCGTCCTGAAGCCCTCACGATAGGTGTGTCATTATAGCGGACAAAGGTCACGATCACAAAGGTGGTGGCGATGATTCCCAATATTGCAACAAACACAGGCACCACAGCCCAGGGAGAATGCCACTCCAATTTGATGATGGGGATAAGCTGGCAGCCTGTGCGGTTCATGTTGGGTCTCTGATCCAGAGGGCAAAGTTCACAGGACAGCTCATCCACCTGGTAGTTGTAACCTTCACAGCGTTCACAGTGCCAGCAGCAAGGGACCCCTTTCACCGTTTTCTTCCTCTCCCCTGGCTTACACGGCAGGCTGCAGACAGACGCCGGACACAGTAATTTTAGCAGAATGCTAATAGGACAAAACTGAAAATTAC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-ARF5-16-1
PMID26117828PNCT_HSA110918
NONCODEv4NONHSAT123119