An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT123588.1

General info


NONCODE TRANSCRIPT IDNONHSAT123588.1
NONCODE Gene IDNONHSAG048908.1
Chromosomechr7
Start Site137531775
End Site137533814
Strand+
Exon Number1
CNCI Score-0.1042319
Length2039
Assemblyhg19
Other transcript VersionsNONHSAT123588.2

Sequence


>NONHSAT123588.1
CTCTTCCTAAATCCCGAGCGAAAGCCCAAGCTGAACATGAACTCTGCCCGGAGGCGACGGGCTGCGGCGGAGGGGGAGAGAGAGGAGGACAGGCTGCGACCCCGGGCTGGGGACGCCAGGGCAGGGACAGCGAGCATCAGGAAGGAGAGCGTCCGGGGAACTCGAGTGGCCGCGCCCTGGGTCCTGCACCGTGAGGCTGGGGGGACCAGGACCGGCGGGCGCCCACCTTGGTCCTGAGCCCAGCTGCCGACGCTGGGCCAGCACCCTCTCCACCGCCGCCCTCCAGTGAGCAGAGCTGGGCTCAGGCAGCAGCCCCTGGGCGCGGGAAGGTAGCGGGAGCTGCATTTAGGGGAGGGGGGAGGTAGCAGGAGCTCCGCCAGTGGGAACCTTGGAGTGAATTCGTCGGCGGGTGCCAAGTCGAAGCGCCGACCTCCTGTCTCTGGACTGGGGCCCGGACCCCTGCGTCCCCAAACTGCGTCCCCGCCTTGCTCGTCGCCCGGTGCCTTCCTTAGGCGCAGCAGACCCTCGGTAAACAGCGGTTAATTCGATGGAATCGGATCACAGGGCCCTCGGTGAAGCAGAAAGGCGGAGGAAATCCAGGAGGCAGAAGTGAGGACCCTGGCGCCTGGCGCCGCTGCGTTGTTCGTATAAGAAGAGGCATCCCGGAAGGGGCTTCAAACCACTTAGGACCGACTGCTGAAACGAATCCAAGCTTGTGGTGTCTGCAGAATTTAACTGTCCGCCTCAACCCCAGTTTTTGTTTCTAAGATTATCGAAAACTGTGCGGTTTGAGTGATGTGCTACAAAGTGTTTAAAACAGATTGTTTCCCAAATTAGGGGTTTCCACACAAGAAATCGCTGCTGTC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3Human
noncodeV3n341335
NONCODEv4NONHSAT123588
lncipedialnc-AKR1D1-5-1_dup1