An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT123770.1

General info


NONCODE TRANSCRIPT IDNONHSAT123770.1
NONCODE Gene IDNONHSAG048993.1
Chromosomechr7
Start Site141985578
End Site141988698
Strand+
Exon Number2
CNCI Score-0.6803428
Length384
Assemblyhg19
Other transcript VersionsNONHSAT123770.2

Sequence


>NONHSAT123770.1
GTGGTGAAAAAGGGACACAGATTGTCTCCAGAGACCAGGCCTGCTATAGCAAATTTCTAGTTGGAAAACAAGAAAGATCTTGGAGGAAAGGAATATACAGGCGACACTAAAGCCACTGCTCAGGGTGTTGTCCCAGCCAGAGATGAGGCACTGAGTACCAGCCGCTGCACAGGATCTTGGCAGAGAGATGGTGGCCACTTGAGAGTTGATGGTGGCGACTGAGCTCAGCTTAATCAGCATGATGTCATTATCAATGGTGGCTGAGTTATACTTGGGGTGGCAAATAATCTTGGCTGCATTTATGAATTGTTCATTGCCTTCATAGACCTTAATGTTGTATTCTCCAAGATGCACATGGATTTGGCTGGATTAAAAGATATAAGA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA111557
ensemblENST00000486508
lncipedialnc-RP11-1220K2.2.1-2-1_d
NONCODEv4NONHSAT123770
gencodeENST00000486508.1