An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT123794.2

General info


NONCODE TRANSCRIPT IDNONHSAT123794.2
NONCODE Gene IDNONHSAG048998.2
Chromosomechr7_KI270803v1_alt
Start Site417511
End Site417967
Strand+
Exon Number2
CNCI Score-0.0274432
Length363
Assemblyhg38
Other transcript VersionsNONHSAT123794.1(old version)

Sequence


>NONHSAT123794.2
TCCCATCCTTCCCTGACCCTGCCATGGGCACCAGGCTCCTCTGCTAGGCGGCCCTCTGTCTCCTGGGAGCAAACTCACAGAAGCTGGAGTTGCCCAGTCTCCCGGATATAAGATTATAGAGAAAAGGCAGAGTGTGGCTTTTTGGTGCAATCCTATATCTGGCCATGCTACCCTTTACTGGTACCAGCAGATCCTGGGACAGGGCCCAAAGCTTCTGATTCAGTTTCAGAATAACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAAGATCCAGCCTGCAAAGCTTGAGGACTCGGCCGTGTATCTCTGTGCCAGCAG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
04.3788000.446506000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0000000.2114350.000155843
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000.00167767002.29805
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset