An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT123825.1

General info


NONCODE TRANSCRIPT IDNONHSAT123825.1
NONCODE Gene IDNONHSAG049013.2
Chromosomechr7
Start Site142762694
End Site142763945
Strand+
Exon Number4
CNCI Score-0.0163840
Length497
Assemblyhg38
Other transcript VersionsNONHSAT123825.1(old version)

Sequence


>NONHSAT123825.1
CGCATCCAGGTGAGACTGGGAGAGCACAACGTCGAAGTTCTGGAGGGGAATGAGCAGTTCATCAATGCAGCCAAGATCATCCGCCACCCCAAATACAACAGTTGGACTCTGGACAATGACATCCTGCTGATCAAGCTCTCCATGCCTGCTGTCATCAATGCCCACATTTCCTCATCTCTGGCTAGGGCAACACTCTGAGCTCTGGTGCCAACTATCCAGATGAGCTGCAGTGCCTGGACACTCATGTGCTGACCCAGGCTGACTGTGAAGCCTCCTACCCTGGAGAGATTACCAACAACATGTTCTGTGTGGGTTTCCTTGAGGGAGGCAAGGATTCCTGCCAGGGTGACTCTGGTGGCCCTGTGGTCTGCAACGGACAGCTCCAAGGAGTTGTCTCCTGGGGCTATGGCTGTGCCCAGAAGAACAGGCCTGGAGTCTACACCAAGGTCTACAACTATGTGGACTGGATTAAGGACACCATAGCTGCCAACAGCTAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000539842
NONCODEv4NONHSAT123825
PMID26117828PNCT_HSA111585
lncipedialnc-PRSS1-2-1