An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT124124.1

General info


NONCODE TRANSCRIPT IDNONHSAT124124.1
NONCODE Gene IDNONHSAG049129.3
Chromosomechr7
Start Site150372548
End Site150373296
Strand-
Exon Number1
CNCI Score-0.1024000
Length748
Assemblyhg38
Other transcript VersionsNONHSAT124124.1(old version)

Sequence


>NONHSAT124124.1
TTAATACCAGAGGATGGAGGGTCTTCCTTTCCACTGGTGGCTCCTCTAGCCAGAGGGCTCTAAGGGGCGGATGCTATTGCTGCTTTTCCAGGGCACAGGGCAGTCAGGACGGAGCCTTAGCACACACCAGCTGGAGGCCGGCGTCCCTGCGCTTGGAAGTGGGTTCCCTGGCCACCGGGGTTGACCTCTCTCGCTAGCAGGGCCCACCCAGCTCACTCCCCGCGTCTTCCATCCCCTCTAGGATTCCCATTGTCCCCTACTCCAGCACTAGGCAGGCACCCCCAGCCCACTGCGACTCCCACCACGAAGGACCCCAGCCCTCTCTCAGCCAACACGGCCCCGCCCACCGTCTCAGACATCGTGCTTCTTCTGGTGGGCCAGGAGTCTCTCCTCGTCGTCGAAGGTCTGGCCACAGATGGCACAGCAGAAGGCGCCGTCCCGGATGTGGCTCTTGCGGTGGGTGATGAGGTTGGACTTCTGGCTGAAGCTGCGGTCGCAGTCGGGACAGGCGTAGGGCCGCTCGCCCGTGTGGATGCGCCGGTGCGACACCAGGTTGGACTTCTGGCTGAAGGCTTTGCCGCAGTCGGGGCAGACGTAGGGCTTCTCGCCGGTGTGGATGCGCCGGTGCGCCGCCAGGTAGGGTTTGTGGCGGAAGGCCTTGCCGCAGTCGGGACACACGAAGGGCCGATCGGGGGCGTGGTCGCGCCGATGCGCCGCCAGATGGCTGCCCTGGGAGAAGCGGCGGCCG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT254662.1
NONHSAT254663.1
NONHSAT124111.2

Data Sources

Source NameOld Id
noncodeV3n341359
lncipedialnc-RARRES2-2-2
NONCODEv4NONHSAT124124
noncodeV3Human