An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT125367.1

General info


NONCODE TRANSCRIPT IDNONHSAT125367.1
NONCODE Gene IDNONHSAG049665.2
Chromosomechr8
Start Site19238385
End Site19245500
Strand-
Exon Number2
CNCI Score-0.0004096
Length393
Assemblyhg38
Other transcript VersionsNONHSAT125367.1(old version)

Sequence


>NONHSAT125367.1
GAGCTTCCCCTGAAGATTGGAGGGGATGAGTCAGGGGCAAGGAAGGATTAACAGATTCTGCCTCAAGTCCTGGTGAACCAACTCCTCTCCCCAAGACAGACACATACTAGTGAAATAAATTGGATTTAAATCATCACCTGAGGCAATCCTGAAAGAGAAAAGCAGTCCTAGAAAAGAGTGGAGGAAAAGAGGACAGCCCCATTCTCTTTGTGACCACGAAGACTGCCGCCATGTGGTTGGGAGCCACGTAACTTCTTTTAGTGCCAGCTGAGATTCTTCTGCCCTGGAACTAGTTCCTCCGAGTTATTGCCAGGCCTGGAGATTGAATTCCTGCAGCTGGAAGGTGGGGAAAGAATAAACCAAGGAAAGGGGAACTGCAAAAGAAAAGCTTTC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT125351.2
NONHSAT125352.2
NONHSAT125360.2
NONHSAT125361.2
NONHSAT125362.2
NONHSAT125363.2
NONHSAT125364.2
NONHSAT125365.2
NONHSAT125368.2

Data Sources

Source NameOld Id
NONCODEv4NONHSAT125367
PMID26117828PNCT_HSA113084
lncipedialnc-PSD3-1-6_dup1