An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT125368.1

General info


NONCODE TRANSCRIPT IDNONHSAT125368.1
NONCODE Gene IDNONHSAG049665.2
Chromosomechr8
Start Site19244847
End Site19245527
Strand-
Exon Number1
CNCI Score-0.0356352
Length680
Assemblyhg38
Other transcript VersionsNONHSAT125368.1(old version)

Sequence


>NONHSAT125368.1
AAGTTCTTTTGCCAATGGCAACCAGCAGAGCTTCCCCTGAAGATTGGAGGGGATGAGTCAGGGGCAAGGAAGGATTAACAGATTCTGCCTCAAGTCCTGGTGAACCAACTCCTCTCCCCAAGACAGACACATACTAGTGAAATAAATTGGATTTAAATCATCACCTGAGGCAATCCTGAAAGAGAAAAGCAGTCCTAGAAAAGAGTGGAGGAAAAGAGGACAGCCCCATTCTCTTTGTGACCACGAAGACTGCCGCCATGTGGTTGGGAGCCACGTAACTTCTTTTAGTGCCAGCTGAGATTCTTCTGCCCTGGAACTAGTTCCTCCGAGTTATTGCCAGGCCTGGAGATTGAATTCCTGCAGCTGGAAGGTGGGGAAAGGTACGGACAAATGAGCTATGAATTTAACAGGCTAACATCCCAGCTCCACAGGGCTGTGGCCAGAGAGGAATTCTCCCCTTTCAAAGCTGACTCCGGATTGCTTAGAGAAAGAAGCGAATAATAATTGAGTCAGAATGAGAAGTCCTTCCTTCCTTCTCAGGAGGATGTCCTGTTAGCAACTTCTTTGGACACAAGGAGGAAATTAAGAAGCATCATTACTGTTAATATCATTTTCTTTTTCAGAATGTTAACAGCCTTGATATTATACAAAGGTTGATAAAAATGTATTTCATAAGTCAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT125351.2
NONHSAT125352.2
NONHSAT125360.2
NONHSAT125361.2
NONHSAT125362.2
NONHSAT125363.2
NONHSAT125364.2
NONHSAT125365.2
NONHSAT125367.2

Data Sources

Source NameOld Id
lncipedialnc-PSD3-1-4_dup1
noncodeV3Human
NONCODEv4NONHSAT125368
noncodeV3n341456