An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT126059.2

General info


NONCODE TRANSCRIPT IDNONHSAT126059.2
NONCODE Gene IDNONHSAG049985.2
Chromosomechr8
Start Site37908740
End Site37909035
Strand+
Exon Number1
CNCI Score-0.1331200
Length295
Assemblyhg38
Other transcript VersionsNONHSAT126059.1(old version)

Sequence


>NONHSAT126059.2
ggggcatggtggtatgcacctgtagtcccagctactcaggagtctaaggctggaagattgcttgagcccaggagttctgggctgtagggcactaggttgatttggtgtctgcactaagttcagcatcaatacggtgagctcctgggagcatgggaccaccaggttgcctaaggagggatgaaccatcccaggttggaaacggagcaggtcaaaactcctgtgctgatcagtagtgggatcacacctgtgaacagccactgcactccagcctgggaaacatagcgagaccctatct

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
2.177530000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
01.8475603.978391.93787
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
9.89604004.349210
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT126059
lncipedialnc-GPR124-2-1_dup1
ensemblENST00000478855