An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT128220.1

General info


NONCODE TRANSCRIPT IDNONHSAT128220.1
NONCODE Gene IDNONHSAG051002.1
Chromosomechr8
Start Site105578313
End Site105578657
Strand+
Exon Number1
CNCI Score-0.6766069
Length344
Assemblyhg19
Other transcript VersionsNONHSAT128220.2

Sequence


>NONHSAT128220.1
ATAGTGGGTGTGCTGAAGACCACTGGCCTTGTGGGATTGGCTATATGCAAGAGTCCATAAGAGAGGCTGAGAATATTGTACACAAAGATTCTTGATGTTCTTGAGCAAATCCCTGAAAATGCAGCACATAGAAAGTATACAGAACAGATTACAAATGAGAAGCTGGCTATAGTTAAAGTAGAACCAGATGTTAAAAAATTAGGAGACCAACATTAAGGTGATCAAGTAGAAGAGGTGATTCCTCAGGTTGAAGATTAACTAAGTCTGGTGAGGAAAATGACGCAGTGAAAACCATGGGAGCCTTAGGGGAAGAGCCTCCTGCCAATCAGTGGAAATGGCCAATA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000519723
lncipedialnc-RP11-127H5.1.1-2-1_du
NONCODEv4NONHSAT128220