An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT130919.1

General info


NONCODE TRANSCRIPT IDNONHSAT130919.1
NONCODE Gene IDNONHSAG052096.2
Chromosomechr9
Start Site35060832
End Site35061610
Strand-
Exon Number3
CNCI Score-0.0368640
Length288
Assemblyhg38
Other transcript VersionsNONHSAT130919.1(old version)

Sequence


>NONHSAT130919.1
CATGAAGCTGGCAGATGATGTGGACCTGGAACAGTAGCCAATGAGACTCACGGGCATGTGGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTGCAAGCCATCCGCAAGAAGATGGATCTCATTGACCTAGAGGATGAGACCATTGATGCCGAGGTCATGAACTCTCTAGCAGTTACTATGGATGACTTCCGTGGGCCTTGAGCCAGAGTAACCCATCAGCACTGCGGGAAACCGTGGTAGAGGTGCCACAGGTAACCTGGGAAGACATCGGGGGCCTAGAGG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-FANCG-2-1
noncodeV3n336719
NONCODEv4NONHSAT130919
PMID26117828PNCT_HSA312228