An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT131423.1

General info


NONCODE TRANSCRIPT IDNONHSAT131423.1
NONCODE Gene IDNONHSAG052346.1
Chromosomechr9
Start Site45656240
End Site45656586
Strand-
Exon Number1
CNCI Score-0.0387784
Length346
Assemblyhg19
Other transcript VersionsNONHSAT131423.2

Sequence


>NONHSAT131423.1
ATTGGACATTTATGTCTTGGATCTAGTGCTTTCCCTAGTCTAGGTTTAAGACCGGATGTAGTATGCCTTTGGAAAGCCTCAGGACCCAGAGGTCAGAGTTCACATTGGCCATGTTCATCCATACCAAGCTGCAAACCCTGGAGCATGTGACTGAGGCCTTATTTAGGGCCAAATTCAAGTTCAGTGAATGCCCAAAAAGCCACATCTCAAAGAAGTGCGATTTTACTAAGTTTAATGCATATACATTTTAAGACTTGGTGGCTGAGAAACAACTCATCCTGGATGGCTGTGGGGCCAAATATAGCCCTGGAATCATGGGCCCCTGGACAAGCAGCTAGCCCTGCAT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id