An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT131816.2

General info


NONCODE TRANSCRIPT IDNONHSAT131816.2
NONCODE Gene IDNONHSAG052529.2
Chromosomechr9
Start Site70383007
End Site70383452
Strand+
Exon Number1
CNCI Score-0.1167360
Length445
Assemblyhg38
Other transcript VersionsNONHSAT131816.1(old version)

Sequence


>NONHSAT131816.2
caccactctgcagtaacatctacctgttgctcaggccatagacttgagggtcattaccggacttttttatgccttacccccgacatcctaacatcaccaagtccaaatgactctgcctctgatgtatttcttgaaactattcacttctttccactgctaaccttcgggtctggaaaaccatcatcttttgcctggacaaatagaaatctcctggctagtctcccagcttccactcttgtccctctaaaatccattttccctggcactcataaagagcttgctgaaatacaagtgggatcgtagcattcttctgctttaaagcttccaacagattgcccctccccttagaatcaaaatcaaacaccgttttacaacctgcaatacgtggcccttgtgaactgggccctgacaaccaccccagcacttcccttcccttcttgtccag

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00.4464550.47367700.27758000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00.8162070.6715420.30359800.35745300
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.23920400000.28566200
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00.45277121.868209.64385
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
10.69810023.07920
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT131816
PMID23818866FPKM1_group_33124_transcr
lncipedialnc-SMC5-5-1_dup1