An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT131874.1

General info


NONCODE TRANSCRIPT IDNONHSAT131874.1
NONCODE Gene IDNONHSAG052560.1
Chromosomechr9
Start Site75356067
End Site75356533
Strand-
Exon Number1
CNCI Score-0.0560151
Length466
Assemblyhg19
Other transcript VersionsNONHSAT131874.2

Sequence


>NONHSAT131874.1
ACACAGATTTTCTTTAAAAACCCTTATGGGAAAGACCATCACTCTGGAGTTTGAACCCTTGGATACAATAGAAAATGCGAAGTCCAAGATCTAGGATAAGACAGGAATTTCTACTGATCAGCAAAGACTGATCTTTGTTGGCAAGAAACTGGAAGATGGATGTGCTTTGTCTGGGTACAACATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCATGGTGGTGCTAAGAAAAGGAAGAAGTCTTACACCACTCCAAAGAAGAATAAGCATAAGAAAAGGAAGGTTAAGCTGGCTGTCCTGAAATACTATAAGGTGGATGAAAATGGCAAAATTAGTCAACTTCATCAAGAATGCCCTTCAGATTAATGTATTGCTGGAGATTTTGTGGCCAGCCATTTTAACAGTCATTGTTGTAGCAAATGTCTGCATTATTGTTTCAACAAACCAGAAGACAAGTAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-ALDH1A1-6-1
ensemblENST00000447672
NONCODEv4NONHSAT131874