An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT132903.1

General info


NONCODE TRANSCRIPT IDNONHSAT132903.1
NONCODE Gene IDNONHSAG052751.2
Chromosomechr9
Start Site90681353
End Site90691589
Strand-
Exon Number2
CNCI Score-0.3214765
Length458
Assemblyhg19
Other transcript VersionsNONHSAT132903.2

Sequence


>NONHSAT132903.1
CCCCGCCCGGCAGGGGAAATGAAGGGAGGGTGGTGTGAGAGCTTCTGCCAGGGGCAGAAGGACACCGAGGGACCGCAAGCAGAGCCGAGGGAGTGCGCGCTAGCCCCGGAAGAGGGATTTTTCATGGGCCGATCTGCTGAATTCAGCCTAGGAGCTGAGACCAACATCTGAGTCTCTTCAGCACACAAGTTTGAAAGAAGTCCTAGCAACTTCAAGCTCAGAACTACGGGTGGCAGCAGCTCCCTCTTGACGTCGAAGCCTCCCATTCCAGAGAGAGTCAAGGCCTGGATCAAACAAAGCCCACAAGCACCGATGACTGAGCTGCTGACTACCCCCAGCATCTCCAACTCAACCTCCTCTTTCTGCCTCTACCCAAATTTTAAAACTTTCAAACATGGGTTTAAAAATGGTAATGAGTAAAGTTGCATCCAAGTGTATCAAATAAAACTAAATATCCA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT132899.1
NONHSAT220953.1
NONHSAT220954.1
NONHSAT220955.1
NONHSAT132900.2
NONHSAT132901.2
NONHSAT132902.2
NONHSAT132905.2

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA121089
lncipedialnc-CDK20-8-6_dup1
NONCODEv4NONHSAT132903