An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT134870.1

General info


NONCODE TRANSCRIPT IDNONHSAT134870.1
NONCODE Gene IDNONHSAG053508.1
Chromosomechr9
Start Site130696781
End Site130703134
Strand+
Exon Number3
CNCI Score-0.0160024
Length480
Assemblyhg19
Other transcript VersionsNONHSAT134870.2

Sequence


>NONHSAT134870.1
GGGGGTTTAGGATCCAAAGCCCAAGTGGGCAGTTCTGCCTGGACTGGAGGACAGAGCATGGAGCAGGTGGGGAGAGGGCAGGTGTCTGCAGTTGGCCTTTTTCCTCTGTGATGAGGAAGATACCTCCACCAACTGGAAGAAAAGAATCTGGAACGATGAAGGTGATGATTGTGCCTGTGGCCAAGACCGGGAGAACCCTGGATCCCTACACCTTCCCCACCCCTGGAATGTCACTATACATATCTGACTTCTTCTGATGTTGCCTTTGACCCTAAAGTCAATATGATAAAGTAACAAGAAGCTGGGACAGAGGAACAAACACAGCCCACTCAAGCAGTGGTGGCAACATTCTGTTAGAAAGGAGGGGAGTCAAAGAAAAAAACACCCCTCCGCCCATCTCCTTATCACCTCCCTAAAGACAGAGGAGAACATGGACACCCTCCATCCTGATAGACATGCCATGTGGTCAGTTTGTGCGGT

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT134873.1
NONHSAT134874.1
NONHSAT134875.1
NONHSAT134876.1
NONHSAT134877.1
NONHSAT134878.1
NONHSAT134879.1

Data Sources


Source NameOld Id
ensemblENST00000592240
NONCODEv4NONHSAT134870
lncipedialnc-FPGS-2-2_dup1
gencodeENST00000592240.4
PMID26117828PNCT_HSA122589