An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT134870.2

General info


NONCODE TRANSCRIPT IDNONHSAT134870.2
NONCODE Gene IDNONHSAG053508.2
Chromosomechr9
Start Site127934502
End Site127940855
Strand+
Exon Number3
CNCI Score-0.0040960
Length480
Assemblyhg38
Other transcript VersionsNONHSAT134870.1(old version)

Sequence


>NONHSAT134870.2
GGGGGTTTAGGATCCAAAGCCCAAGTGGGCAGTTCTGCCTGGACTGGAGGACAGAGCATGGAGCAGGTGGGGAGAGGGCAGGTGTCTGCAGTTGGCCTTTTTCCTCTGTGATGAGGAAGATACCTCCACCAACTGGAAGAAAAGAATCTGGAACGATGAAGGTGATGATTGTGCCTGTGGCCAAGACCGGGAGAACCCTGGATCCCTACACCTTCCCCACCCCTGGAATGTCACTATACATATCTGACTTCTTCTGATGTTGCCTTTGACCCTAAAGTCAATATGATAAAGTAACAAGAAGCTGGGACAGAGGAACAAACACAGCCCACTCAAGCAGTGGTGGCAACATTCTGTTAGAAAGGAGGGGAGTCAAAGAAAAAAACACCCCTCCGCCCATCTCCTTATCACCTCCCTAAAGACAGAGGAGAACATGGACACCCTCCATCCTGATAGACATGCCATGTGGTCAGTTTGTGCGGT

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
01.69069e-18000.03995840
foreskinheartheart_RHLF_1HLF_2kidney
02.27984e-080000
liverliver_RlunglymphNodeovaryplacenta_R
003.57925e-0900.122510.140705
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000.0605113.25853e-148.66516e-080.25258
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
03.7778101.90499.52786
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
11.392008.025240
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset