An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT134873.1

General info


NONCODE TRANSCRIPT IDNONHSAT134873.1
NONCODE Gene IDNONHSAG053508.1
Chromosomechr9
Start Site130700161
End Site130703130
Strand+
Exon Number3
CNCI Score-0.0932124
Length575
Assemblyhg19
Other transcript VersionsNONHSAT134873.2

Sequence


>NONHSAT134873.1
GGCTTTGGACTGCGGAGCACGCCGGGAGTCGTAGTCCCCAGGCCTGCTCGGGCCCACCTCGTCGGAGACGAGCAGGAACCGCCTCCTCTTCTTTGCATATCGGCGAAGTGTAGTTCTCAAGAGCATTGTGGGGCCGGTTGCTGCCCGAATCTCTCTAGGGAATGGGACCGAGTTGGGGACCCAGACTCCCTGGCCTTCATGGCCACAGTCCTGTCGCCGCCCCACCAAAAGCCAATCTCTAAGAATCTGGAACGATGAAGGTGATGATTGTGCCTGTGGCCAAGACCGGGAGAACCCTGGATCCCTACACCTTCCCCACCCCTGGAATGTCACTATACATATCTGACTTCTTCTGATGTTGCCTTTGACCCTAAAGTCAATATGATAAAGTAACAAGAAGCTGGGACAGAGGAACAAACACAGCCCACTCAAGCAGTGGTGGCAACATTCTGTTAGAAAGGAGGGGAGTCAAAGAAAAAAACACCCCTCCGCCCATCTCCTTATCACCTCCCTAAAGACAGAGGAGAACATGGACACCCTCCATCCTGATAGACATGCCATGTGGTCAGTTTGTG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT134870.1
NONHSAT134874.1
NONHSAT134875.1
NONHSAT134876.1
NONHSAT134877.1
NONHSAT134878.1
NONHSAT134879.1

Data Sources

Source NameOld Id
NONCODEv4NONHSAT134873
PMID26117828PNCT_HSA122593
ensemblENST00000587978
gencodeENST00000587978.4
lncipedialnc-FPGS-2-3_dup1