An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT135303.1

General info


NONCODE TRANSCRIPT IDNONHSAT135303.1
NONCODE Gene IDNONHSAG053690.2
Chromosomechr9
Start Site133338989
End Site133339465
Strand+
Exon Number1
CNCI Score-0.0028672
Length476
Assemblyhg38
Other transcript VersionsNONHSAT135303.1(old version)

Sequence


>NONHSAT135303.1
ATGACGAACACAAAGGGAAAGAGGAGAGGCACCCAATATATGTTCTCTAGGCCTTTCAGAAAACATGCAGTTGTTCCTTTGGCCAAGTATATGCAAATTGATGAGAAAGGTGATATTGTAGATATCAAGGGAATGGGTACTGTTCAAAAAGGAATGCCCCACAAATGTCACCATGGCTAGACTGGGAGAGTCTACAGTGTTCCCCAGCATGCTGTTGGCACTGTTGTAAACAAGTAAGGGCAAGATTCTTGCCAAGAGAATGAATGTGCATATTCAGCACACTAAGCACTCTAAGAGCCGAGAGAGCTTCCTGAAACGCGTGAAGGAAAATGATCAGAAAAAGAGGGAAGCCAAAGAGAAAGGTACCTGGATTCAACTGAAGCGCCAGCCTGCTCCACCCAGAGCAGCACACTGTGAGAACCAATGGGAAGGAGCCTGAGCTGCTGGAACCTCTTCCCTATGAATTCATGGCATCG

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
lncipedialnc-RPL7A-2-1_dup1
NONCODEv4NONHSAT135303
ensemblENST00000439130