An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT135772.1

General info


NONCODE TRANSCRIPT IDNONHSAT135772.1
NONCODE Gene IDNONHSAG053889.3
Chromosomechr9
Start Site138249270
End Site138252157
Strand+
Exon Number2
CNCI Score-0.0004096
Length730
Assemblyhg38
Other transcript VersionsNONHSAT135772.1(old version)

Sequence


>NONHSAT135772.1
CATAGGGACGTGTTATTGAGAAGCAACTTTTGCTTGGTTTTCAGAGAAATGGAATCATCGTATCGCTGATCTACGTAAACAAACTGAAGAATTGTCTGAAAGAAAATATGACATGAACTTATGAATTCAACAGGTGAAGATTTACAACTTGATAAATCAACTTTGTCAGGTACGTCTTCAGTCAAGTCAGATTAGAAGATTATGTGAGGTAATTAACACTTAACATTGATTTAATGGTAGCTTCCACATGAAATAGTATGCCTCTAAGTATTAATTATGTCCTAGGACAGGAGAATTCATGTTGTCAAAATTCTCATACTCTCTAGAACAATAAACTCATTTTCTTTTTATTAGTAAATATTGCATTTATGGGTAGACAAAACTGAAAGAACAATATTTGTTCTACTTTTGAGATGCAAGATTCATCTGGCATAATGCATTGAACAGGTTATTATTGAAGTCTACACCAGTCAACTGAATAAGCATTCATCAAATGTCCATGATATGCAGGACATAAGTTTTCTTTTAGAGTATGGAACCATGCATATTATCTTTTAATTAGATGATTTAGTTAGATATGTTTTTAAAGAACTAGAAATATAATTGTTTTTCTTGTTTTGGCTCTGGAGTGGAGTGGGGATGAAACAGAATGGATTCACACTTGTTTAGATTTACTAAAATGGAAAGATTGCAGCAAGATCATATCCCTAGTCTCCCTATAGCAAATGTC

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT257252.1
NONHSAT135770.2
NONHSAT135771.2

Data Sources


Source NameOld Id
NONCODEv4NONHSAT135772
noncodeV3n371055
lncipedialnc-CACNA1B-1-3_dup1
PMID26117828PNCT_HSA321775
noncodeV3Human