An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT135772.1

General info


NONCODE TRANSCRIPT IDNONHSAT135772.1
NONCODE Gene IDNONHSAG053889.1
Chromosomechr9
Start Site141139720
End Site141142607
Strand+
Exon Number2
CNCI Score-0.1027606
Length730
Assemblyhg19
Other transcript VersionsNONHSAT135772.2

Sequence


>NONHSAT135772.1
CATAGGGACGTGTTATTGAGAAGCAACTTTTGCTTGGTTTTCAGAGAAATGGAATCATCGTATCGCTGATCTACGTAAACAAACTGAAGAATTGTCTGAAAGAAAATATGACATGAACTTATGAATTCAACAGGTGAAGATTTACAACTTGATAAATCAACTTTGTCAGGTACGTCTTCAGTCAAGTCAGATTAGAAGATTATGTGAGGTAATTAACACTTAACATTGATTTAATGGTAGCTTCCACATGAAATAGTATGCCTCTAAGTATTAATTATGTCCTAGGACAGGAGAATTCATGTTGTCAAAATTCTCATACTCTCTAGAACAATAAACTCATTTTCTTTTTATTAGTAAATATTGCATTTATGGGTAGACAAAACTGAAAGAACAATATTTGTTCTACTTTTGAGATGCAAGATTCATCTGGCATAATGCATTGAACAGGTTATTATTGAAGTCTACACCAGTCAACTGAATAAGCATTCATCAAATGTCCATGATATGCAGGACATAAGTTTTCTTTTAGAGTATGGAACCATGCATATTATCTTTTAATTAGATGATTTAGTTAGATATGTTTTTAAAGAACTAGAAATATAATTGTTTTTCTTGTTTTGGCTCTGGAGTGGAGTGGGGATGAAACAGAATGGATTCACACTTGTTTAGATTTACTAAAATGGAAAGATTGCAGCAAGATCATATCCCTAGTCTCCCTATAGCAAATGTC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT135770.1
NONHSAT135771.1

Data Sources

Source NameOld Id
NONCODEv4NONHSAT135772
noncodeV3n371055
lncipedialnc-CACNA1B-1-3_dup1
PMID26117828PNCT_HSA321775
noncodeV3Human