An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT136238.1

General info


NONCODE TRANSCRIPT IDNONHSAT136238.1
NONCODE Gene IDNONHSAG054007.2
ChromosomechrX
Start Site10482461
End Site10495715
Strand-
Exon Number2
CNCI Score-0.0122880
Length298
Assemblyhg38
Other transcript VersionsNONHSAT136238.1(old version)

Sequence


>NONHSAT136238.1
CTTACCATTGTACTTATCCTGTAGGTCAATGCATCACGTCAAGAAGCCAAATTGACAGAGGAGTGTGATCTTCTCATTGAGATCATTCAGCAAAGACGACAGATTATTGGAACCAAGATCAAAGAAGGGAAGTGATGAGGCTTCGCAAACTGGCTCAGCAGATTGCAAACTGCAAACAGTGCATTGAGCGGTCAGCATCACTCATCTCCCAAGCGGAACACTCTCTGAAGGAGAATGATCATGCGCGTTTCCTACAGACTGCTAAGAATATCACCGAGAGGTGAGTGCAGGGGCCCCT

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT136235.2
NONHSAT136236.2
NONHSAT136237.2
NONHSAT136241.2
NONHSAT136242.2
NONHSAT136243.2
NONHSAT136245.2

Data Sources


Source NameOld Id
NONCODEv4NONHSAT136238
noncodeV3n335221
PMID26117828PNCT_HSA323621
lncipedialnc-GPR143-3-8