An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT136241.1

General info


NONCODE TRANSCRIPT IDNONHSAT136241.1
NONCODE Gene IDNONHSAG054007.2
ChromosomechrX
Start Site10501441
End Site10567162
Strand-
Exon Number3
CNCI Score-0.0843776
Length373
Assemblyhg38
Other transcript VersionsNONHSAT136241.1(old version)

Sequence


>NONHSAT136241.1
ACGCTGTGAAGACCTGTGTCACTTGTGAAGTATCCTACTGTGACGAGTGCCTGAAAGCCACTCACCCGAATAAGAAGCCCTTTACAGGCCATCGTCTGATTGAGCCAATTCCGGACTCTCACATCCGGGGGCTGATGTGCTTGGAGCATGAGGATGAGAACAAAACTTAGAGAGTAACCTCACCAACCTTATTAAGAGGAACACAGAACTGGAGACCCTTTTGGCTAAACTCATCCAAACCTGTCAACATGTTGAACTGTAAAGGATCAGAAAGTCATTGGCAGAGAGAAGCAGCAGTATTACCCTAGGAATAGGAGAAAGTGGGTCAGCAACTCCCTACAGGCAAGACTGATGGGGAGAAGATGCATTTCAA

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT136235.2
NONHSAT136236.2
NONHSAT136237.2
NONHSAT136238.2
NONHSAT136242.2
NONHSAT136243.2
NONHSAT136245.2

Data Sources


Source NameOld Id
NONCODEv4NONHSAT136241
PMID26117828PNCT_HSA323624
lncipedialnc-GPR143-3-2
noncodeV3n335229