An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT136396.1

General info


NONCODE TRANSCRIPT IDNONHSAT136396.1
NONCODE Gene IDNONHSAG054099.2
ChromosomechrX
Start Site17099781
End Site17100239
Strand-
Exon Number1
CNCI Score-0.0471040
Length458
Assemblyhg38
Other transcript VersionsNONHSAT136396.1(old version)

Sequence


>NONHSAT136396.1
CTCTACCGTCGATTGGTAAAGGGCAAAGTGGAGTACCTCCTAAAGTGGAAGGGATTCTCAGATGAGGACAACACATGGGAGTCAGAAGAGAACTTGGATTGCCCTGACCTCATGAGTTTCTGCCGTCACAGAAAACAGCACATGAGATAGACAAATCAGAGGGAGGCAAGCACAAAGCTGATTCTGATTCTGAAGATAAGGGAGAGGAGAGCAAACCAAAGAAGAAGAAAGAAGAGTCAGAAAAGCCACGAGGCTTTGCTCAGGGTTTGGAGCCGGAGCAGATTATTGGAGCTACAGACTCCAGTGGAGAGCTCATGTTCCTGATGAAAGGGAAAAATTCTGATGAGGCTGACCTCGTCCCTGCCAAGGAAGTCAATGTCAAATGCCCACGGGTTGTCATATCCTTCTATGAGGAAAGGCTGACGTGGCATTCCTACCCCAAAGAGGATGATGACAAG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT136396
ensemblENST00000453841
lncipedialnc-RBBP7-2-1