An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT136428.2

General info


NONCODE TRANSCRIPT IDNONHSAT136428.2
NONCODE Gene IDNONHSAG054119.2
ChromosomechrX
Start Site18897204
End Site18901584
Strand-
Exon Number4
CNCI Score-0.0655360
Length310
Assemblyhg38
Other transcript VersionsNONHSAT136428.1(old version)

Sequence


>NONHSAT136428.2
CACATCCAGCCCTACCATCTCCATCCACGAGGTGGGCCATACCGGAGTCACCAAAACTGAGAGGAGTGGCATTAACAGACTGAGGAGTGAAATGAAACAATGACTAGGCGGTTTAGTGCTGATGAACATTCTTTTCTGTGGGCCAGGCCGCGTCCAGCAGTGCGCATTCCTCCAAGTCTGCAGGTCCAGCACCCCATCCTCGCCCACTGGCACGTCATCCTCAGACTCGGGAGGACATCACATCGGCTGGGGTGAGCGGCAGGGCCAGTGGCTGCGCAGGAGAAGGCTGGATGGGGCCATCAACAGGGTC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
021.368926.70915.36385.5323
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
7.0629006.213090
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT136430.2

Data Sources


Source NameOld Id
noncodeV3n335986
NONCODEv4NONHSAT136428
PMID26117828PNCT_HSA323998
lncipedialnc-GPR64-3-2