An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT136636.1

General info


NONCODE TRANSCRIPT IDNONHSAT136636.1
NONCODE Gene IDNONHSAG054239.1
ChromosomechrX
Start Site37805136
End Site37806028
Strand+
Exon Number1
CNCI Score-0.1667086
Length892
Assemblyhg19
Other transcript VersionsNONHSAT136636.2

Sequence


>NONHSAT136636.1
ATGGCAACAAATGAAAGTGCCAGCATCTGTAGTTCAGCATTTGTAGCTGTGGAGTATGTAGATTCACTTTTACCTGACAGTCCTCTGCAAGAACCATTTTAAAATGCTTGGAATTGTATGTTAATAATTATACAATGTTCTAGATTGCAACATGGGGATCTGCTATTGTTCATGAAAACTTTTATTTCTTGTTCTTTTTACCTGGGTTTCTATTTCAATTTATACCTTGCATTAAAAAGAATAACATTGAAAAATATAAACCAGAGACATAGGAAAACCAACGGAAGTGCTTTAAATTACTTCTCTTTAATCACTTTTGTATCCAGCTGCTTTTATGTGTGGAACCTATTATTTTACAGAGTATTTCAATATTCTTTATGATTGAAAAAGAATGACAAAATGGTATATGCTTTTGGTAAGGTGCTTTGGCTATACTACAGTCTTTGATACTACTTGGCACTATTTCTAAGCCTGCATAGATTCTTTTACCACAAAAAGAATATGTAAATAGATTCATAAAATTCATCATGAGTTTCAAGCTCCATTTGGAATAGAAGCTGAATATGCACATCCTTTGGAAATTCTAATTCTTGGAACTGGATTTTTCATTGGAATCATGCTTTTGTGTTACCATGTAATTAATTCTTCTTTGGACATGGGTGACAATTTATTTGATAGAAACTATTGATGCCCATCGTGGTTATGATATTCCTCTCAAACCTTTAAATCTCATCCTTTTCTATGCTGGTTCTCAGCATCATGATTTACACCACATAAACTTCATCAGAAAGTATGCTTCTACATTTTCATGGTGGAATACAATTTTTCGAACACACTTTCAGTTTAATGTTTATAGTGAAAATATGAAGAAGTTTGAGAAAAAGCTGAATAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT136636
lncipedialnc-CXorf27-2-1_dup1
ensemblENST00000428051