An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT137740.1

General info


NONCODE TRANSCRIPT IDNONHSAT137740.1
NONCODE Gene IDNONHSAG054869.2
ChromosomechrX
Start Site82497668
End Site82497924
Strand-
Exon Number1
CNCI Score-0.0212992
Length256
Assemblyhg38
Other transcript VersionsNONHSAT137740.1(old version)

Sequence


>NONHSAT137740.1
TCACTATATTATGCCAGTTTTTTGGAAGTCTTAGTTTGAGATGTGTGTATTTCCTTGGAAATTGATGACTTGAAAAAAATTGCCAATTCACTGACAGTGCTTTGCAATGAAAAACAGAAGCAAGAAAAGCAAAGCACAGCAGAAAAGAAGAAAGGTGTGGTTCCTGGAGGAGGATTAAAAGCCACCATGAAAGATGATCCGGCAGATTATGGTGGTTATGATGGAGGATATGTACAAGATTATGAAGACTTCATGT

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
lncipedialnc-HMGN5-6-1_dup1
NONCODEv4NONHSAT137740
ensemblENST00000448435