An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT138729.1

General info


NONCODE TRANSCRIPT IDNONHSAT138729.1
NONCODE Gene IDNONHSAG055403.1
ChromosomechrX
Start Site135889381
End Site135890036
Strand-
Exon Number1
CNCI Score-0.1860231
Length655
Assemblyhg19
Other transcript VersionsNONHSAT138729.2

Sequence


>NONHSAT138729.1
GTGGCTGCCCAAGGAGAGCCCCAAGTCCAGTTCAAATTGGTATTGGTTGGTGATGGTGGTACTGGAAAAACTGCATTCATGAAATGTCATCTGACCAGTGAATTTGAGAAGTGTGTAGCCACCTTAGGTGTTGAGGTTTATCACCTTGTGTTCCACACCAACAGAGGATCTATTAAGTTCACTATATGAGATACAGCTGGCCAGGAGAAATTTGGTATACTGAGAAATGGCTATTATATTCAAGCCCAGTGTGCCGTTATAATGTTTGATGTAACATCTTGAGTTATTTACAAGAATGTGCCTAACTGGCATAGAGATCTGGTATGAATATGTGAAAACATCCTCATGTTGTATGGCAACAAAATGGATATTAAGTATGGGAAAGTGAAGGAAAAATCTACTGTCTTCTACTGAAAGAAGAATCTTCAGTATTATGACATTTCTGCCATAAATGCCAAAAAGTAACTACAACTTTGAAAAGCCCTTCCTCTGGCTTGCTAGACAGCTCATTGGAGACCGTAACTTGGAATTTGTTGCCATGCCTGCTCTTGCCTCACCAGAGATTGTCATGGACCCAAATTTGGCAGTTTAGTATGAGCATGATTTAGAGGTTGCTTAGACAACTGCTCTCCCAGATGAGGATGATGACCTGTGA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT138729
lncipedialnc-ARHGEF6-1-1_dup1
ensemblENST00000413361