An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT139084.1

General info


NONCODE TRANSCRIPT IDNONHSAT139084.1
NONCODE Gene IDNONHSAG055552.2
ChromosomechrX
Start Site153649659
End Site153650155
Strand+
Exon Number2
CNCI Score-0.1966080
Length203
Assemblyhg38
Other transcript VersionsNONHSAT139084.1(old version)

Sequence


>NONHSAT139084.1
TTCTTTCCGGAGGCCATTGAGTTCATTGTGAGGCCTTGTCCCAGAACTGCGGGGTGCTCGTCCACTGCTTGGCGGGGGTCAGCCGTTCTGTCACCGTCACTGTGGCCTACCTCATGCAGAAGCTCCACCTCTCTCTCAACGATGCCTATGACCTGGTCAAGAGGAAGAAGTCTAACATCTCCCCCAACTTCAACTTCATGGGG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT139084
PMID26117828PNCT_HSA329083
lncipedialnc-SLC6A8-1-1
noncodeV3n334629