An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT139335.1

General info


NONCODE TRANSCRIPT IDNONHSAT139335.1
NONCODE Gene IDNONHSAG055679.1
ChromosomechrY
Start Site6182795
End Site6184282
Strand-
Exon Number3
CNCI Score-0.0535124
Length410
Assemblyhg19
Other transcript VersionsNONHSAT139335.2

Sequence


>NONHSAT139335.1
GCATGCTGCTGCAGCCACACTTTCAACAAAACAACTTCTCCTGATGCCTGGATTTCAATCTGGACCCAATCCTGGACAAAAACCTCTTAAGCAATCAGAACTCAATGTTTCCCGGTTGAGTGTCAACTAGCTGTAATCTGGAAGTTTCCAGGCTTTCTGGCTCTTCAAGACAGCTGTTATTTCTCATGAAACCACAGAGTGTGGATTATGCCCTGGCCATATCACCCACTGTCACAACCGCTGGGAGTCAGAAATTGGTGAATTCTCTTGAATAGTTTCTGTACAACGTTCTGTCTCCCATTTCTGTGCTGGCTCCATACTAAATGAACACTATTTCCTTACTACAGCTAGATGTGTCAATTTTATGTAAACTCAGCAGCCCTGGCCCTGGTCCAAGTGGAGCTTAATCA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-AMELY-4-1_dup1
noncodeV3Human
NONCODEv4NONHSAT139335
noncodeV3n371634
PMID26117828PNCT_HSA329515