An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT140220.1

General info


NONCODE TRANSCRIPT IDNONHSAT140220.1
NONCODE Gene IDNONHSAG016373.2
Chromosomechr15
Start Site28789826
End Site28808298
Strand+
Exon Number7
CNCI Score-0.0040960
Length731
Assemblyhg38
Other transcript VersionsNONHSAT140220.1(old version)

Sequence


>NONHSAT140220.1
ATTATTTGCAACTGCCATGGATGTTTACAGGAACCCAGCCAGAGTTTGCCTCCCTGCACTTCATCCCAGAGCGCACCTGCTTCCTCCACTTCACCTTCGGAGAGGACACTTCAAACTGCGGACACACGCAAAAGCAACTCCCAGCTCTGTTTGATGTTACTCGTTCCTCAGCAAGTTGGCAAAACAGATATCATGCTGGCAATTGAAAAGCTGCAGGCGGGTGCTCTTGCAACTGACGCAGTCACTGCAGCACTGGTGGAACTTGAGATCTGTTTGAGGAGATGGTGCCTGTGTCAGTGTGGCAGTCTTTGGCTGCCTGTGATCAGAGGAAAGCCGATTTGTTAACAGATCAATTGCTCAGATGAGAGAAGCCACCACTTTGGCAAATGGAGTGCTAGCTTCCCTTAATCTTCCAGCAGCAATTGAAGATGTGTCTGGAGACACTGTACCTCAGTCTATATTGACTAAATCAAGATCTGTGATTGAACAGGGAGGCATCCAGACTGTTGATCAGTTGACTAAAGAACTGCCTGAATTACTGCAATGAAATAGAGAAATCCTAGATGAGTCATTAAGGTTTTTGGATGAAGAAGAAGCAACCGATAATGATTTATGAGCAAAATTTAAGGAACGCTGGCAAAGGACATCATCCAATGAACTGTATAAGCCTTTAAAAGCAGAGGGAACCAGCTTCAGAACAGTTTTAGATAAAGCTGTGCAAGCAGATGGAC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT041271.2

Data Sources

Source NameOld Id
lncipedialnc-APBA2-5-2
NONCODEv4NONHSAT140220
ensemblENST00000562423