An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT142117.1

General info


NONCODE TRANSCRIPT IDNONHSAT142117.1
NONCODE Gene IDNONHSAG019255.1
Chromosomechr16
Start Site33750744
End Site33751015
Strand-
Exon Number1
CNCI Score-0.1183282
Length271
Assemblyhg19
Other transcript VersionsNONHSAT142117.2

Sequence


>NONHSAT142117.1
TAGTAAAGCCCTCAGAGACCCTCTCCTTCACCTGTGCCGCCTCTGGATTTCCGATCATAACCAGTACTTCCTCCTGGAGCTGGATCTGCCAGCCCCCAGGGAAGGAGCTGAAGTGGGTCAGGTGTGTAGGTCATGAGGAAGCACACAGTACCACCCGCTTCTCAAGAGTCCAGTCACCACCTCCAGATACACATTCAGAAAGCAGTTTTTCCTACAGCTGAGCTACATGTGCAATGAGTACACCACCATGGATTTTTATGCAAAAGACACA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-AC140658.1-3-1_dup1
ensemblENST00000567603
NONCODEv4NONHSAT142117