An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT142494.1

General info


NONCODE TRANSCRIPT IDNONHSAT142494.1
NONCODE Gene IDNONHSAG019455.1
Chromosomechr16
Start Site52068769
End Site52112444
Strand-
Exon Number6
CNCI Score-0.1531477
Length490
Assemblyhg19
Other transcript VersionsNONHSAT142494.2

Sequence


>NONHSAT142494.1
AGACCACCTGCCCTCAAAAGATTTGTTTTCTAGAGAAACAAAGCAAAATCTAGGTGCTGCAAGAAAAGTCACAGCCTTGGGGTTTCAGTGAAGAGACAGCCCAAATGCTCTTGAAGTAGTCAGAAAAGTCTACAGGTGTGACTCCCTTATGCCGCTCTCTCCTGCCATTTGGGCAACAGCCAACTTCCGAGGCCAACCTTGTTTCTGGAGAAGCATTCTTCCCACATGGGAAAGGCAAGGATGGTGCTGAGCCTGTCTGCCTCTGTGTTCCCTGGACAACTCCATTCCAGTGCAAGATTCTCATGGTTGAATTCATATTTTAAGTGCTGTTTGTGGGGTTTTGAGCAGTTGCCATTCTGAGGAGGAGCAGAGGAGCATGGCTTTGCCAAAGTGTCTCCCAATTATGAGCACCATCTGCAAGAGTCCACTTGGAAAATACTCAAGAGTGGGCTTCTATGACTTCTGCCTTGCCCTGGAGGTCCAATACAGG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT142490.1
NONHSAT142491.1
NONHSAT142492.1
NONHSAT142493.1
NONHSAT142495.1
NONHSAT142496.1
NONHSAT173869.1
NONHSAT173870.1
NONHSAT173871.1
NONHSAT173872.1
NONHSAT173873.1
NONHSAT173874.1

Data Sources

Source NameOld Id
noncodeV3n375257
noncodeV3Human
NONCODEv4NONHSAT142494
PMID26117828PNCT_HSA206062
lncipedialnc-RP11-152O14.5.1-1-2_d