An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT142728.1

General info


NONCODE TRANSCRIPT IDNONHSAT142728.1
NONCODE Gene IDNONHSAG019550.2
Chromosomechr16
Start Site57013070
End Site57014100
Strand-
Exon Number1
CNCI Score-0.1163264
Length1030
Assemblyhg38
Other transcript VersionsNONHSAT142728.1(old version)

Sequence


>NONHSAT142728.1
GTTTTGAAGCCTGTGGACCTTAATGGTGTCATCAAACTTTTTGAAGAGACTGCTAAAGAAGGCTTAGAAGAAAAGCAACTTAAATCTGTCAAGAAACTGGTACAGTGTTATCAGAATGAACTTCCCTTAAGGGATTTAGTACAGACATTTGAAATTCTGAATCTGTGTGCAGTAAAAATTGAAAACCAGCCGCATTTTGTAGAATCTGCATATGATATCATAAAATAGTGTGGCTTGCCATTTTTGAAAAAGAAAGTATCGGATGAAATAACTTATGCTGGAGATACTGCTAGTTCAGTTGCGCTTCTGGGTGACTTAATGAAAATACCAAGTTCTGAATTGAGGATAAAAAATTGTAAACGTATTGTTGACTTTTATCAGGCACAACCACCAAAGGAGCATATTCCAGGTTACCAGCAAGTGAGTTCATCATACAAGATTCAAATGGCTGAAGTTGGAGGATTGGCAAAAACAATGGCCCAGTTAATGACCTTGCTTGAAAATCAACTTGTTGAGAAACTTTGGGTACTTAAAATTCTGCAGCATCTCTCGACTTCTGAAGTTAATTGTACTGTAATGATGAAAGCACAAGCAGCCAATGGAATCTGTGCTCACCTCAATGACTCAGATTTCTCTGGACAGCTTTTATTTCCTTCATCAGAAACACTTTGGAACTTATCAGAAAAAATCTTCAAAATAAGAAATTGTTCAACAGCTTAGTAACTTGGAATGTTTACTGACTTTGAAGGAAGTATTTTAAAATCTATGAGAGGTTTTAGTCATTATGACCGTCAGCTTAGAAATGACATATTAGTGATCACTACAGTTATAGCTCAAAATCCTGGAGTGCCAAAGATTGAATGTGGCTTTACCAAGGATTTGATACTGTTCGCAACCTTTAATGAAGTTAGAAGTCAATCCCTTTGGTAAAGGACTTAAATTTTCTAAATCCTATGAAGATTTTGAGTTGAATAAATTACTATTCACTATAATTGTGATCTTATGTAAAGATTTAAATACTATACAGGTA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT142728
lncipedialnc-FAM192A-3-1_dup1
ensemblENST00000566704