An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT143139.1

General info


NONCODE TRANSCRIPT IDNONHSAT143139.1
NONCODE Gene IDNONHSAG019751.1
Chromosomechr16
Start Site67576025
End Site67576866
Strand-
Exon Number2
CNCI Score-0.3133963
Length336
Assemblyhg19
Other transcript VersionsNONHSAT143139.2

Sequence


>NONHSAT143139.1
TGGGGAGTTCTGGGGGCCATAGGGTCTGCCTGAGTGTAGGAATTGGAGACTGGGGGACTACAGGGAAGGGAGTCAGTGCCTGGGAGGGTGGGGTCTGAGTGTTTGGAGGGGCTGGAGAGGATGTGGGGACAGAGCCTGTTGTACCGAGGGTAGAGCTTGTGGCAGAGTGGCCAGGGTCCAGGGCAGGAGGAACAGGACTGGGGTGCTCTCCATGGGTGGGAGCTGGGTGTGTAGGTGGGCTAGGTCCCCAGGCTAGGCTTTCTGGGCCAACGGCCTCCACTGAAGCCTCAGCCAAGGCAGCATCTACACTAGCCTCACTGATGTGGCTCAGAGTCC

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT143140.1

Data Sources


Source NameOld Id
lncipedialnc-AGRP-3-1_dup1
ensemblENST00000563083
PMID26117828PNCT_HSA044258
gencodeENST00000563083.1
NONCODEv4NONHSAT143139