An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT143140.1

General info


NONCODE TRANSCRIPT IDNONHSAT143140.1
NONCODE Gene IDNONHSAG019751.1
Chromosomechr16
Start Site67576206
End Site67576475
Strand-
Exon Number2
CNCI Score-0.3849412
Length207
Assemblyhg19
Other transcript VersionsNONHSAT143140.2

Sequence


>NONHSAT143140.1
GGACTGGGCCTATGATATTGAGGGTAGGGCCTGTAGTAGTAAGGGTAGAGATTATGGGCTTGTGGGTGGAGCCTGTAGTAGTTGGTGTGAGTGGGGCCTGGCAGTTCTGAAGGGCCAGAGTCTGTGGACTTATGAACTGAGTCTAGGTGTGCAGATGGGGCAGGGTCTGTAGATGTGGGGACAGAGCCTGTTGTACCGAGGGTAGAG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT143139.1

Data Sources


Source NameOld Id
lncipedialnc-AGRP-3-2_dup1
gencodeENST00000564717.1
NONCODEv4NONHSAT143140
ensemblENST00000564717
PMID26117828PNCT_HSA044259