An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT144476.2

General info


NONCODE TRANSCRIPT IDNONHSAT144476.2
NONCODE Gene IDNONHSAG020325.2
Chromosomechr16
Start Site89166382
End Site89169147
Strand+
Exon Number3
CNCI Score-0.0598016
Length1326
Assemblyhg38
Other transcript VersionsNONHSAT144476.1(old version)

Sequence


>NONHSAT144476.2
ATGCAGTGGAGGAGAGGACAGACGTCCGGAACTGGGTAGAGATGGGCCTGCCGTGGGTGCGATCTGCTGGGGACACAGACCCACGCAGCAGGGGAGAGGACAGACGTCCGGAACTGGTGCTGTCCCACGTCCCCACCCCTGTGGCCAGCTCCGCCCACTCAGCCTCAGCCTTGCTGGGGCCTGGCCCGACCTCAGGAGTCCCTGCTGGCCTGGCCACCCTTGTGCCTTCGCCTCAGCCATCGGGGAGGCTCGGGTGGTCTCAGGGCCAACGCCAGGTGAGACCTCAGGGGGGGTCAGGGGCTTCTGAACAAAAACGGCACCCCCATACCTGATGGGGCTCCTCTGAGCCCACCTGGACTGACCCCCTGTGGCCGCCAGGGGCAGCTGGTGGCCTGCCTGAATGTGGGGGCAGTGTCACCCCTGAGCCCAGAGAGCCGGAGCACAGCAGGGTCCAGGATGGCCCCAGCTACAGACACTGCCTGGCTTCCTCCACACCCCGAGATCCAGCTGCGTCTCCTCTGTCCCGGGGAAACTTACGGGAAACTTATGGGCGGAAGTCCCTCTGCAGGGCCCACTACCCAGAGCCAGCCACATGCACTCAGGCCAGGGCTCAGGGGCCGTGGGGGCTGGTGGCCCCAGCCCTTCTGGATCCACTCCCCACCCCTCACTCACTCCGTGGGGACCTTCATCTGCCTAGATGGGCTGGTCTGTGCTCTGACGGCCCCAGGACTGGGTGTCGGCCTCACCCCAGCGCCCTGGCGGCCTCCCGGCCAGAGTAGAATGTTGGAAGGGCATGGCCCATGGCCGACGCCAGGCTCCCGGCCAGGGCCCACCTGTGTTTGTCTCCTCACCCCGGCCTCCTCCAGCCTCAGGCCCTGCCTGTCAGACAGGGGCACTTGCCCAGGGGCTCCTCAGGGAGCAGTTGGTACCTGCAGAGCAAGCCCCCAGAGCCCCTGCCACAGGCACCCCAGCCTCAGGTCAGGTCTGGAATGGACACAGCCCCCAGACCAAGACCAGGGCCTCCTCACCCCGGGGTCCCCTCCCTTGGTGTCGGGTGTCACCCAAACTCCCTGGACGTCACCCTTCTGCCCTCCACGCCCCACACCCTGGGTAGGAGCCGCCTTCACAGCTGCTAACCCCTGCCCTCCAGCCCCCACTGCCTCTTCGGTAACGGGGCTGTGACTGGCCTAAGCCCTGGGCCTCCACAGGGCCCCTGTCCAGCCCACCTTGCTCAACCGCAGCGTTCCGCATCACGCCTGCCCCTTAGTGGTTGGGGTGTGCATGTATATTTATACACTGTAATTACATAAATACAATTTAATAATC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
0.2818910.4940340.1025970.03587040.2611790.225261
foreskinheartheart_RHLF_1HLF_2kidney
0.4437680.2085550.18821800.1339840.403028
liverliver_RlunglymphNodeovaryplacenta_R
0.213050.09074190.01832460.3331380.1763190.380738
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.4154220.4308490.16260.5984370.2311320.254701
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
003.12209018.5444
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
24.75130013.06590
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset