An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT144573.2

General info


NONCODE TRANSCRIPT IDNONHSAT144573.2
NONCODE Gene IDNONHSAG020361.2
Chromosomechr16
Start Site89711855
End Site89718165
Strand+
Exon Number4
CNCI Score-0.0561152
Length1753
Assemblyhg38
Other transcript VersionsNONHSAT144573.1(old version)

Sequence


>NONHSAT144573.2
AAAGCCTGGGCCCGTGGGGGACGCACATGGTCCTGTTCGTACTCCAGGATGGCGGCGTAAAGGGCCCGCTGCTCCCGTTCCTCCGGGGTCAGGGCGACTTGGCTGCAAAACCTCCTGGGGAGAAAGGCACGCGGTGGGTGCCGGGGCCAGGCCCTCCCCGCAGCGGCCCCAGGGGCGGGCAGGAGTCCCACCTGTTGGCGGCCTCCTGGAGCCGCAGCCGGCGCTCCTCCATCTTTCTCTGGAGCTGGGTGCAGAGTCAAGGGGCCGAGCGTGGGATCTGAGCGGGCCCTCGGTTCCCAACCCCGTCCCACACCCGGAGAGGCCGGGACGTCCCAGGGACCTCCTCTCGGTGAGGGGCTGTCCCCAGGGAGGCCTCCTCCAGTGGCGTCAGCTCTCTGGAAATGTGACAAGCTGCTGTCTAGACCCCAGGAAGCCCAGTGGTGTCTGGACACCAGAGGAGTCTCTCTCATCCTCCCGGATTGCTCTGAGGCCAGGAGCTTTGTGACTCTGCCCCCTGAAGCTTCTGGAAGATCTCGGGTGGCAGAAAAGGAGAGAGCTTTCCTCCTTCATCGGAGTATACACGGCGGTGTCGGCCGGCAGGCTGGGGAATGGGAGCAGCTGCAGGCATGGTTGGCTTCAGGCGTGTTTTCCCTGCAAGCCATGGGTAACCAGGGGTCAAGCGGTGGGCCACATCCCACAGAGGAGATGCGGGCTTGGGGGATGCCCCAGGAGAGCCGCCTACTGCAGGAGACCCACCAAGCTTGGCGGCCGTCGACTGGGCCCTCTCCAGACACTGCTGTGCTAGCTTCAGCATCTTGGAGGTGTCGGGGGGCACAGTTTCCCCAGCTTCTGGGGGAGGGACAAGAAGGCTGGTCACAGTCGGCTCTACCACTGTTACTTACTGCTGAGATAAAATGAGGCAACGGAAAAGGCCTCTGGGAAGTGGCCGTTTTACAGAGACAAGGACGTGCTGAGGGGATCGCCTCACCCATCTCCCACCGGCTGTGTCCCCAAAGTCCTGCCTTCCCGTAGCTTGGCATGGAGCACCTCTGCGCGACCATGGACCTGCTCACACAGCCCTTCTGCGCGCCGTGGGAGCTGCCTCTCTGTGACTCGCCCCTGGACCCACCGCCCCAGCGCCTGACCCACCTCCCTGCTGCCCTTCACAGAAAACTTCTCATAGACTCCCATTTTCTCATCCCGCCCCGATTTAGCCCCCGACTCCCCCCGGAAACTGCCCTTACCCGTCCCCACCTTGCCAGACACGGTGGGCCACTGGAGTTCCTCTGTCTTCTGGGACTTTGCTCTCCCCAGGGGATCCTCTGCCACTCCTCCACCCAACTCCTCAATCTTGGAGCGCCAGAGCTCAGCCGAGCTCACCGGCTCCCTAGGGAGCTGGGGCAACTGTTAGCTCCCCCTGACCTGTGTGATCCTACGTCCAGTGGCTGCCCCGACCTCTGTGATCCCACGTCCAGGGGCTCCCCCGACCTCTGTGATCCCACGTCCAGTGGCTCCCCCGACCTCTGTGCTCCCACGTCCAGTGGCTCCCCCGACCTCTGTGCTCCCACGTCCAGTGGCTCCCCCGACCTCTGTGCTCCCACGTCCAGTGGGTCCCCCTGACCTCTGTGATCCCACGTCCAGTGGCTCCCCCTGACCTCTGTGCTCTATGTCCAGTGGCTCCCCCTGACCTCTGTGATCCTTTGTGCAGCGGCTGCTGGCCTCTCAAACTTAATGTGTTCATTGCGGAACTTGC

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
3.127993.70731.458631.948472.333262.35987
foreskinheartheart_RHLF_1HLF_2kidney
3.884891.090950.6533731.265241.795663.18657
liverliver_RlunglymphNodeovaryplacenta_R
0.9564160.23062.291812.472383.680112.78216
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
2.621192.385374.00373.380683.555493.79869
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
022.165610.785728.157910.927
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
10.4211004.026314.85421
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset