An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT144605.1

General info


NONCODE TRANSCRIPT IDNONHSAT144605.1
NONCODE Gene IDNONHSAG020376.2
Chromosomechr16
Start Site89923423
End Site89934772
Strand+
Exon Number4
CNCI Score-0.2818048
Length296
Assemblyhg38
Other transcript VersionsNONHSAT144605.1(old version)

Sequence


>NONHSAT144605.1
AGGCCGGCCAGTGCGGCAACCAGATCGGGGCCAAGTCTGGGAAGTCATCAGTGATGAGCATGGCATCGACCCCAGCGGCAACTACGTGGGCGACTCGGACTTGCAGCTGGAGCGGATCAGCGTCTACTACAACGAGGCCTCTTTCACAAGTACGTGCCTCGAGCCATTCTGGTGGACCTGGAACCCGGAACCATGGACAGTGTCCGCTCAGGGGCCTTTGGACATCTCTTCAGGCCTGACAATTTCATCTTTGTCAGAGTGGGGCCGGCAACAACTGGGCCAAGGGTCACTACACG

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
NONCODEv4NONHSAT144605
noncodeV3n334226
lncipedialnc-MC1R-1-3_dup1
PMID26117828PNCT_HSA207955