An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT145796.2

General info


NONCODE TRANSCRIPT IDNONHSAT145796.2
NONCODE Gene IDNONHSAG020907.2
Chromosomechr17
Start Site15260512
End Site15261841
Strand+
Exon Number1
CNCI Score-0.0688128
Length1329
Assemblyhg38
Other transcript VersionsNONHSAT145796.1(old version)

Sequence


>NONHSAT145796.2
TGCCAGAAACTTCCCTGGGACGTCTGAGACTTCCAACTGTCTGCAAATAACACAGTCCTGAACCAGCAGGAGCACGGGCTGGGAACCCAGATGGGGAAGGGCGGGCCGCGCAGGGAGCCTCCCCGCCAGGCACTCACGCTGACGATCGTGGAGACGAACAGCAGCACCAGCACCGCGACGTGGAGGACGATGATACTCAGCAACAGGAGGAGCATTCTGGCGGCAAGTTCTGCTCAGCGGAGTTTCTGCCTGCGAGGAGAGCGCTGGGCGTGAGGCCGAACGCACTGGGCCGAGCGACGGAGGCGCGCGCAGAGGGAGGGTCCCGCGCACTAGCGGAAGGCCCGGCCTGGCCCAGCGCCCGCAGCCCGACCGCCCGCGCGGGTCAGGAGCCTTCGCGCCGCCTGCCGCCGAGAGGGGGCAGCAGCCGCCTGCAGGACCAGCGCCCAGTGCCCAGCGCCCAGCCGGGCCCGCCTGCAACGGAACATCTTTTGCTTTTGGAAACAAAACAAGCGGTTCGCACGTCTAAAACCACCCAGGGAACGGAGGGGTTTCCAGAAAATATGAGCAGAGGCCACTGCACGCTTCCACCCACCCCAAGCACCTCCCGGCGACCTCCCTGGAAGGTGAGAGGTCACGTTCTCCGAGACCCCGGTTCAGATGGTGAATTCCCCTATGGGGTGGAGGTAGGGGTGAGGGGAGTAGGTGCCCAGATTTCCGTCTGAGACCTGGAGACAGCCGTGGCATGCGGTGGGGGAGACAGCGGCGAGGAGGCTGGTTTCCCAGACCCCAGTGCTCTCCGCATTCCGTTTGTCTCCAAGTTTCCACCCAACTCTGCCAGCGTAGAGGAACGGTCCTGGCCCCAGCTCAGCCTCGCGCAGACTCTGGCGGCTCCGGAGAGGTGGTGCAGAGCCAGAGTAGTGTGGAAAGAAAAGAATGGCTCGAGAGGGTTGCCCGGACCCTGCGCTTCCCGTCCACCGCGCGCTTCCCCAGGCAGCCCCTGGGGTCAGGGGGCATTCTGCTCTTGCGCTAGACCCACGTGCTCGCCTAGGGGTCCAGTCTGCACCCCAGGCACTCAAAGCCAGGACACGAACCCCAACAAGCCTGAGCTCCGGTCTGGGTGCGGTGGGACAGGAGCCCAGGAGCCTGGACCGAAGGGAGTAGATGTCCAGCGGACGGGAGAGAGAGACAGAGGGTAAAAGGCTGAGTCCGAGAATTTCAGCCGGTCAGAGCCGGCAGGACATTTATCCCAAGTAATGCGGTCCTCGCCCCTCATTTTAAACTTTGGGGGAACTGAAGGCTGGGATGACCTGTTAGAGGACATGCATGGCT

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
00.007244760.042487600.007264130.00701986
foreskinheartheart_RHLF_1HLF_2kidney
0.007376130.0013334500.003628170.006681340.00558255
liverliver_RlunglymphNodeovaryplacenta_R
000.003046130.008476080.01329520
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.006576600.0032429600.002195060
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
043.69115.5558247.26629.67542
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
17.81830011.10090
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset